PLOS ONE: Heterotrimérica G-Protein, Gα16, é um Effector Downstream crítica de não-Canonical Wnt Sinalização e um potente inibidor do crescimento de células transformadas em não pequenas células do cancro do pulmão

Sumário

receptores acoplados à proteína G (GPCR) é a maior família de moléculas da superfície celular que desempenham importante papel /s, de um número de processos biológicos e patológicos, incluindo cancros. Estudos anteriores sobre a importância de Wnt7a sinalização via o seu receptor cognato Frizzled9, um GPCR, na inibição da proliferação de células, crescimento independente de ancoragem, e a reversão do fenótipo transformado no cancro de não pequenas do pulmão de células, principalmente através da activação do supressor de tumor, PPARy. No entanto, as efetoras G-proteína que casal para esta importante via supressora de tumores não foram identificados, e são de potencial interesse terapêutico. Neste estudo, usando dois read-outs específicos-Frizzled9 Wnt7a /independentes, identificamos G

α16 como um romance efetoras a jusante da sinalização Wnt7a /Frizzled9. Curiosamente, G

expressão α16 é severamente regulada para baixo, tanto nos níveis de RNA mensageiro e níveis de proteína, em muitas linhas não pequenas do pulmão de células de células de câncer. Além disso, através knock-downs e expressão das formas GTPase-deficiente (Q212L) do G específicos do gene

α16, nós também estabelecer G

α16 como novo regulador da proliferação de não pequenas células do pulmão de células cancerosas e independente de ancoragem o crescimento celular. Tomados em conjunto, os nossos dados não só estabelecer a importância de L

α16 como um efector a jusante crítico da via de sinalização Wnt não canónicas, mas também como um alvo terapêutico potencial para o tratamento do cancro do pulmão de células não pequenas.

Citation: Avasarala S, Bikkavilli RK, Van Scoyk M, Zhang W, Lapite A, Hostetter L, et al. (2013) Heterotrimérica G-Protein, G

α16, é um Effector Downstream crítica de não-Canonical Wnt Sinalização e um potente inibidor do crescimento de células transformadas em não pequenas células do câncer pulmonar. PLoS ONE 8 (10): e76895. doi: 10.1371 /journal.pone.0076895

editor: Sumitra Deb, Virginia Commonwealth University, Estados Unidos da América

Recebido: 29 de maio de 2013; Aceito: 28 de agosto de 2013; Publicação: 18 de outubro de 2013

Este é um artigo de acesso aberto, livre de todos os direitos autorais e pode ser livremente reproduzido, distribuído, transmitido, modificado, construído em cima, ou de outra maneira usado por qualquer pessoa para qualquer finalidade lícita. O trabalho é feito disponível sob a dedicação de domínio público da Creative Commons CC0

Financiamento:. Este estudo foi apoiado por um Prémio de Mérito do US Department of Veterans Affairs, National Institutes of Health (NIH) concede R01CA1385282522717 e 5R21CA153268- 02 a RAW. Os financiadores não tiveram nenhum papel no desenho do estudo, coleta de dados e análise, decisão de publicar ou preparação do manuscrito

Conflito de interesses:. Co-autor, Dr. Robert Winn é um membro do Conselho Editorial PLOS ONE. Isto não altera a adesão dos autores para todas as políticas de PLoS One sobre os dados e materiais de compartilhamento. Os autores declaram que não existem interesses conflitantes.

Introdução

Wnts são secretados glicoproteínas, que transdução eventos de transdução de sinal chave que desempenham papéis críticos não só durante o desenvolvimento dos mamíferos, mas também em muitas doenças humanas [1 ]. Wnts se ligam aos receptores Frizzled (Fzds), e activar qualquer uma MAPK canónico ou β-catenina via dependente ou vias independentes não canónicas ou β-catenina através de c-Jun N-terminal kinase (JNK), p38 mitogen activada proteína quinase ( ) via ou vias y PPAR (PPARy) [2] – [7]. activação aberrante de sinalização Wnt tem sido implicada em muitas doenças, incluindo o cancro [1], [8]. Nós identificámos anteriormente que Wnt7a é perdida em cancros do pulmão de não pequenas (NSCLC) [5], [6], e restauração da Wnt7a sinalização em linhas celulares de NSCLC leva a reversão do fenótipo transformado [6], revelando Wnt7a sinalização como um via supressora de tumor romance em câncer de pulmão. No entanto, o mecanismo de transdução de sinal Wnt7a a partir da membrana plasmática para o citoplasma e o núcleo permanece em grande parte desconhecida.

A superfamília de receptores acoplados à proteína (GPCRs) é a maior família conhecida de proteínas no genoma de mamífero [9] e a sua disfunção está associada com um número de doenças humanas prevalentes. De facto, os dados experimentais e clínicos indicam que os GPCRs emergentes têm um papel crítico, não só na progressão e metástase do cancro, mas também em muitas outras doenças humanas, tornando GPCRs maiores alvos para os agentes terapêuticos correntes [10]. foi anteriormente demonstrado que os GPCRs estão associados com o crescimento autócrino em pequenas células do cancro de pulmão (SCLC, [11], [12]). Frizzleds são correctamente incluído no receptor acoplado a proteína G (GPCR) superfamília como eles exibem sete estrutura de domínio transmembranar, a sensibilidade à toxina da tosse convulsa e a modulação de cálcio intracelular. Curiosamente, existem dez Fzds diferentes clonadas até agora. Embora, todos os receptores FZD exibir estrutura heptahelical semelhante, continua a ser evasivo como esses receptores sinalizar para diferentes efectores a jusante. Outra propriedade cardeal de GPCRs é que eles sinalizam através de proteínas G heterotriméricas [13] – [19]., Implicando que proteínas G heterotriméricas pode modular os efeitos da Fzds

Temos demonstrado anteriormente que a restauração da Wnt7a /Fzd9 sinalização inibida tanto a proliferação celular e o crescimento independente de ancoragem, promoveu a diferenciação celular, e inverteu o fenótipo transformado em células NSCLC através da activação de PPARy e estimulação de proteínas de e-caderina [5], [20]. No entanto, a proteína-G /s mediando o papel anti-tumorigénica de sinalização Wnt7a /Fzd9 permanece desconhecida. Neste estudo, utilizou-se a activação estimulada-Wnt7a PPARy e E-caderina como leituras e identificar a proteína G heterotrimérica, L

α16, como um importante efector a jusante de sinalização Wnt7a /Fzd9. Curiosamente, também observamos redução da expressão de G

α16; tanto ao nível de transcrição e ao nível da proteína, em muitas linhas celulares de NSCLC. Além disso, usando genes baixos de detonação selectiva e expressão de mutantes constitutivamente activas de proteínas-G, que também demonstram que o G

α16 é crítico para a inibição Wnt7a /Fzd9-mediada de crescimento transformado em NSCLC. Além disso, nós também estabelecer G

α16 como um novo mediador da ativação Wnt7a /Fzd9 mediada por ERK5 e nuclear supressor de tumores receptor PPAR. Tomados em conjunto, G

α16 é mostrado aqui para ser um romance regulador da proliferação de células NSCLC e crescimento celular independente de ancoragem.

Resultados

Identificação de Heterotrimérica G-proteínas reguladoras Wnt7a /Fzd9 sinalização

Para avaliar o possível envolvimento de G-proteína /s na sinalização Wnt7a /Fzd9, fizemos uso de G constitutivamente activo

subunidades a de proteínas G que são deficientes em actividade de GTPase, e sondou sua efeitos sobre dois bem estabelecida Wnt7a /Fzd9-dependentes leituras de

viz.,

transcrição de genes dependente de PPAR e a transcrição de genes de e-caderina-dependente em linhas celulares de NSCLC [5], [20]. linhagens de células NSCLC (H157 e H2122) foram transitoriamente transfectadas com um vector vazio ou um painel de G constitutivamente activo

subunidades a de proteínas G (G

αi2Q205L, G

αoQ205L, G

αqQ209L , G

αzQ205L, G

α12Q229L, ou G

α16Q212L) juntamente com um PPAR-Response Elemento (RE) vector repórter luciferase. Os efeitos da expressão das proteínas G constitutivamente activas na transcrição de genes dependente de PPAR foram posteriormente determinada pela medição da luminescência nas lisados ​​celulares (Fig. 1A, B). Curiosamente, a expressão de G

α16Q212L, mas não G

αi2Q205L, L

αoQ205L, L

αzQ205L, ou L

α12Q229L, resultou num aumento de quatro vezes no PPAR-RE actividade de luciferase em ambas as linhas celulares testadas, um efeito semelhante ao de Wnt7a /Fzd9-estimulada de PPAR-RE actividade de luciferase sozinho (Fig. 1A, B). Para os controlos positivos, uma vez que, as células H157 e H2122 foram reduzidas ou nenhuma expressão Wnt7a, as células foram transfectadas com plasmídeos de expressão Wnt7a [5], [20]. As células H157 foram adicionalmente transfectadas com o plasmídeo Fzd9, como eles não para expressar endógena Fzd9 [5], [20]. Foi também interessante notar que a expressão de G

αqQ209L também induziu actividade PPAR-RE luciferase,

embora

menos eficientemente do que G

α16Q212L (Fig. 1A, B). Os efeitos de ambos os L

α16Q212L ou G

αqQ209L expressão eram específicos para actividade de PPARy, mas não para PPARÔ actividade, uma vez que, a expressão de G

α16Q212L, L

αqQ209L, ou Wnt7a /Fzd9 em H157 e H2122 não conseguiu estimular a actividade da luciferase PPARô-RE, um repórter específica para PPARÔ (dados não mostrados). Desde então, a sinalização Wnt7a /Fzd9 falhou para estimular a atividade PPARa (dados não mostrados), que, portanto, não tentou testar os efeitos de G

α16Q212L, G

αqQ209L na ativação PPAR.

Efeitos de constitutivamente activa G

subunidades a sobre Wnt7a /Fzd9 dependentes read-outs. linhas celulares de NSCLC, H157 (A) ou H2122 (B) foram transfectadas, quer com vector vazio, ou constitutivamente activa L

sub-unidades a de proteínas G em conjunto com os vectores Repórter PPAR-Re-luciferase e CMV-β-galactosidase. Após 48 h, as células foram lisadas e as actividades da luciferase foram medidas tal como descrito nos Métodos. linhas celulares de NSCLC, H157 (C) ou H2122 (D) foram transfectadas, quer com vector vazio, ou constitutivamente activa L

sub-unidades a de proteínas G em conjunto com E-caderina promotor-luciferase repórter e repórter CMV-β-galactosidase vetores. Após 48 h, as células foram lisadas e as actividades da luciferase foram medidas tal como descrito nos Métodos. Os valores da luciferase foram normalizados com os valores de CMV-β-galactosidase e foram representados no gráfico.

atividade constitutivamente activa G induzida por subunidade α PPRE dependente de transcrição do gene ou E-caderina promotor foram representados como a mudança vezes em relação ao controle do vetor vazio. Os dados representam a média ± SEM de três experiências separadas. **,

p Art 0,01; versus o controlo de vector vazio.

E-caderina é um marcador conhecido de diferenciação epitelial [21], [22] e foi previamente demonstrado ser um alvo a jusante importante tanto para sinalização Wnt7a /Fzd9 e expressão de PPARy em NSCLC [6], [23]. Estamos, portanto, também avaliou os efeitos de proteínas G constitutivamente activa na actividade promotora E-caderina nas células NSCLC (H157 e H2122). De forma semelhante aos efeitos sobre a actividade de PPARy, expressão de G

α16Q212L induziu um aumento robusto na actividade do promotor de E-caderina em ambas as linhas celulares testadas quando comparado com os controlos vector vazio (Fig. 1C, D). Os efeitos de L

αqQ209L expressão na actividade do promotor de E-caderina, embora significativo, eram menos potentes do que a de G

α16Q212L expressão (Fig. 1C, D). Tomados em conjunto, estes resultados sugerem uma forte associação das proteínas G, G

α16 e G

αq, com a ativação do PPAR e aumento da diferenciação celular, como mostrado pelo aumento da expressão da caderina-E.

G

α16 Expression é perdido no NSCLC

G

Nós identificamos

α16 e G

αq como mediadores importantes de PPAR e expressão de e-caderina em linhas celulares de NSCLC (Fig. 1). Foi interessante notar que tanto G

α16 e G

αq pertencem à família Gq de proteínas-G. No entanto, uma vez que L

αqQ209L expressão não só mostrou menos potentes efeitos sobre a actividade de PPARy e expressão de E-caderina, mas também teve efeitos pobres e inconsistentes sobre a proliferação NSCLC e de ancoragem independente do crescimento celular (dados não mostrados), que visava avaliar a papel do G

α16, mas não G

αq. A fim de estabelecer um papel potencial para G

α16 em NSCLC, primeiro sondada os níveis de G

α16 expressão num painel de linhas celulares de NSCLC utilizando RT-PCR quantitativa (qPCR, Fig. 2A). Para estas experiências, o ARN total foi extraído de pulmão não-transformadas células epiteliais brônquicas (Beas2B), adenocarcinoma do pulmão (A549, H2122), carcinoma de células escamosas (H157) e linhas de células de carcinoma de células grandes (H661 e H1299), transcrito de forma inversa e o cDNAs foram posteriormente utilizados para medir os níveis de G

expressão α16 (Fig. 2A). Curiosamente, L

expressão α16 foi gravemente atenuada em todas as linhas celulares de NSCLC testadas em comparação com a linha epitelial bronquial não transformada célula (Beas2B, Fig. 2A). Determinou-se também os níveis de proteína de G

α16 nas células não transformadas pulmonares epiteliais brônquicas (Beas2B) e linhas celulares de NSCLC, utilizando um anticorpo específico para G

α16 (Fig. 2B)

. Western blotting de lisados ​​de células NSCLC revelou uma perda total de expressão de G

α16 (Fig. 2B). Embora não haja nenhuma expressão de ARNm detectável, H157 células exibido alguma

a expressão da proteína G α16. Apenas uma especulação, a expressão detectável de G

α16 em H157 pode ser devido ao volume de negócios de baixa proteína. Pelo contrário, as linhas celulares de NSCLC e Beas2B expressaram níveis similares de G

αo (Fig. 2B), a proteína G que é específico para p-catenina via de sinalização dependente [2], [24]. Uma vez que, perda de heterozigosidade (LOH) desempenha um papel importante durante a inativação de genes supressores de tumor (ETG), que também procurou LOH (segmentado intensidade genótipo) em GNA15 /16 lócus (G

α16) em nosso células de câncer de pulmão linhas usando a ferramenta CONAN (Copie Análise Number) (http://www.sanger.ac.uk/cgi-bin/genetics/CGP/conan/) do Projeto do Genoma do Câncer Sanger. Poderíamos detectar LOH em H157, A549, H2122 e H661. Além disso, nós também procurou variações no número de cópias somáticas (CNV) em GNA15 /16 lugar em cancros do pulmão humanos. Para este efeito, os dados da CNV em 493 adenocarcinoma de pulmão e pacientes com carcinoma de células escamosas 416 pulmão foram baixados da Cancer Genome Atlas (TCGA) (http://cancergenome.nih.gov/) Project. estimativas do número de cópia de nível Gene foram posteriormente processados ​​usando GISTIC2 [25] e do gasoduto FIREHOSE TCGA. Surpreendentemente, o estado de mutação de GNA15 /16 lócus foi de 1,22% para deleções e 53,14% para as supressões de cópia única em pacientes com adenocarcinoma de pulmão humano e 0,96% para deleções e 41,34% para as supressões de cópia única em pacientes com carcinoma epidermóide de pulmão humano. Estes dados fornecem provas adicionais para a perda de G

α16 em cancros do pulmão.

A, analisa-PCR em tempo real da expressão de G

α16 em linhas não transformadas e de células NSCLC. O ARN total foi extraído a partir de uma linha não-transformado célula (Beas2B) ou linhas celulares de NSCLC (H157, H2122, A549, H661 e H1299) e G

expressão α16 foi quantificada utilizando o sentido: caccacgctagcctggtcatg e anti-sentido: iniciadores gcgcccttcttgctgccctcggg . β-actina foi utilizado como um controlo interno para normalização. Os dados representam a média ± SEM de três experiências separadas realizadas em duplicado.

##,

p Art 0,01; versus controlo (Beas2B). B, a análise Western blot de G

expressão α16 em linhas não transformadas e NSCLC de células. Quantidades iguais de lisados ​​de células totais de uma linha não-transformado célula (Beas2B) ou linhas celulares de NSCLC (H157, H2122, A549, H661 e H1299) foram separados num gel de SDS-PAGE, transferidos para blots de nitrocelulose e os “blots” foram depois sondado com anticorpos quer anti-G

α16, anti-G

αo ou anti-p-actina.

Papel do G

α16 em NSCLC proliferação celular e Anchorage- crescimento celular independente

estudos anteriores estabeleceram um papel importante para o PPARy na proliferação de células NSCLC, transformado crescimento, metástase, e a diferenciação epitelial [23], [26]. Da mesma forma, também estabelecida a importância de Wnt7a /Fzd9 sinalização em crescimento transformadas reduzida e aumento da diferenciação celular em NSCLC através da indução de PPARy [5], [20]. Se G

α16 é um importante mediador da sinalização Wnt7a /Fzd9, nós raciocinar que G

α16 pode também potencialmente mediar o crescimento de células transformadas em NSCLC. De modo a interrogar o envolvimento específico de G

α16 na proliferação de células NSCLC e o crescimento de células transformadas, utilizou duas abordagens: (1) os efeitos de pequenos RNAs de interferência (siRNAs) específicos para L

α16 e (2) expressão de um G constitutivamente activo

α16Q212L. RNAs de interferência pequeno (siRNAs) visando especificamente quer G

α16 ou G

αo foram projetados, testados quanto à sua especificidade, e então utilizado para suprimir seletivamente G

α16 ou G

αo em células Beas2B. Os reagentes de ARNip quer especificamente suprimida L

α16 ou G

αo, alcançando uma redução de 70% ou mais na expressão de cada proteína (Fig. 3A). siRNAs mexidos projetados pelo fornecedor comercial foram testados como controlos em alguns subconjuntos; eles mostraram nenhuma capacidade para suprimir tanto G

α16 ou G

αo expressão (Fig. 3A). O tratamento das células não transformadas epiteliais brônquicas (Beas2B, com G

expressão α16) com L

siRNAs específica-α16 aumentou significativamente a proliferação celular, tal como determinado por clonogénicas (Fig. 3B) e os ensaios de proliferação celular MTS (Fig. 3C). Embora, o tratamento de células Beas2B com L

αo-específicos ARNsi, uma proteína G que é específico para a via de sinalização β-catenina-dependente [2], [24], não tinha ou efeito modesto sobre as taxas de proliferação celular, em comparação com células de controlo tratadas siRNA, tal como determinado por clonogénicas (Fig. 3B) e MTS ensaios de proliferação celular (Fig. 3C), indicando uma associação específica de G

α16 e proliferação de células NSCLC. Se a nossa hipótese de que L

α16 medeia a proliferação de células NSCLC foram verdadeiro, então a expressão de um mutante deficiente GTPase constitutivamente activa, (Q212L) de G

α16 em células NSCLC deve resultar na proliferação celular reduzida, mesmo na ausência de Wnt7a. De facto, a expressão transiente de G

α16Q212L, mas não G

αoQ205L, em H2122 células resultou em proliferação celular reduzida, conforme determinado pelo clonogénicas (Fig. 3D), ensaios de proliferação celular MTS (Fig. 3E), e /ou análise da curva de crescimento celular de 5 dias (Fig. 3F). Além disso, a expressão estável de G

α16Q212L em H2122 células também inibiu as habilidades de H2122 células a crescer em agar macio, um

in vitro

medida de transformação celular (Fig. 3G). Assim, usando vários ensaios distintos e poderosos, mostramos que G

α16 mas não G

αo regula a proliferação de células NSCLC e crescimento de células transformadas.

A. células Beas2B foram transfectadas com qualquer controle de siRNA ou siRNAs específico para G

α16 ou G

αo. O ARN total foi isolado e analisado quanto a expressão de G

α16 ou G

αo utilizando PCR quantitativa. Normalizado L

α16 ou G

αo os níveis de ARNm ao do ARNm β-actina foram representados nos gráficos.

##,

p Art 0,01; versus controle siRNA. células Beas2B foram transfectadas com ARNsi de controlo ou ARNsi-específico para G

α16 ou G taxas

αo e proliferação celular foram depois determinada quer utilizando um ensaio clonogénico (B) ou um ensaio de MTS (C) tal como descrito em os Métodos. painel superior representa significam ± SEM de duas experiências altamente reprodutível, independente, enquanto as imagens representativas foram exibidos no painel inferior. Os dados representam média ± SEM de três experiências altamente reprodutíveis independentes. *,

p Art 0,05; **,

p Art 0,01; versus controle siRNA. células H2122 foram transfectadas, quer com vector vazio ou constitutivamente activa L

α16Q212L ou G

αoQ205L vectores de expressão e as taxas de proliferação de células foram depois determinadas usando um ensaio clonogénico (D), um ensaio de MTS (E) ou cinco análise dias curva de crescimento celular (F) como descrito nos Métodos. painel superior representa significam ± SEM de duas experiências altamente reprodutível, independente, enquanto as imagens representativas foram exibidos no painel inferior. Os dados representam média ± SEM de três experiências altamente reprodutíveis independentes.

#,

p Art 0,05; G, H2122 células foram transfectadas com vector vazio ou constitutivamente activa G

Q212L α16 e as habilidades das células transfectadas a crescer no soft agar foram depois sondado. Os dados representam média ± SEM de três experiências altamente reprodutíveis independentes.

##,

p Art 0,01; versus controle do vetor vazio.

estimulada por Wnt7a ERK5 ativação é G

α16

Dependente

Nós previamente observado que a expressão de Wnt7a /Fzd9 nas células NSCLC resultados na ativação robusto de ERK5 [5]. A seguir testou se a estimulação de células recombinante hWnt7a Beas2B também é capaz de activar ERK5; por immunoblotting borrões gel SDS-PAGE com anticorpos específicos para fosfo-ERK5 (Fig. 4A). A estimulação de culturas Beas2B com rWnt7a resultou em uma activação rápida de ERK5 atingindo um pico dentro de 15 minutos de tratamento (Fig. 4A). Para verificar se a sinalização Wnt7a /ERK5 estava operando através de G

α16, fizemos uso de G

siRNAs específicos de α16 (Fig. 4B). Nestes estudos, as células Beas2B foram co-transfectadas com G

sub-siRNAs específica α16 com ou sem os vectores de expressão Wnt7a (Fig. 4B). Curiosamente, o tratamento com G

sub-siRNAs específica α16 aboliu a capacidade de estimular a activação Wnt7a de ERK5 (Fig. 4B). Se esgotamento de G

α16 poderia bloquear a activação mediada por Wnt7a de ERK5, então expressão de forma constitutivamente activa de G

α16 (Q212L) deve induzir a ativação ERK5. A fim de testar esta hipótese, fizemos a utilização de uma construção repórter de luciferase dependente de MEF2-C-[27]. Esta mede a actividade repórter ERK5 quinase, como é obrigar para activar a transcrição de genes dependente de MEF2-C-[27]. A expressão transiente de forma constitutivamente activa de G

α16Q212L juntamente com plasmídeos repórter MEF2-C-luciferase resultou em um aumento robusto em actividades de luciferase, tal como determinada nas duas H157 (Fig. 4C) e H2122 (Fig. 4D) linhas celulares de NSCLC. MEF2 C-dependentes actividades de luciferase Além disso, induzidas α16Q212L o G

eram sensíveis ao tratamento de PD98059, que inibe MEK 1, 2, e 5 (Fig. 4C, D), mas não pelo inibidor de MEK1 /2 U0126 (dados não apresentados), indicando a especificidade do nosso ensaio. Tomados em conjunto, estes dados estabelecem claramente que G

função α16 é fundamental para a ativação ERK5 Wnt7a mediada.

A, células Beas2B foram privadas de soro para géis 2-PAGE e depois sondado para ativação ERK5 sondando o blots de nitrocelulose com anticorpos anti-pERK5 e normalizado para o carregamento igual por sondagem com anticorpos anti-ERK5. B, células Beas2B foram transfectadas quer com ARNsi de controlo ou G

siRNAs-α16 específica em conjunto com ou sem Wnt7a vector de expressão. Após 48 h, as células foram lisadas e analisadas para a activação ERK5 sondando as manchas com anticorpos anti-ERK5 pERK5 e. linhas celulares de NSCLC, H157 (C) ou H2122 células (D) foram transfectadas, quer com vector vazio ou G

α16Q212L em conjunto com o repórter luciferase MEF2-C-dependente, seguido por um tratamento sem ou com PD98059 inibidor MEK (20 uM ). Após 24 h, os lisados ​​foram ensaiados quanto a actividade de luciferase tal como descrito nos Métodos. Os dados representam a média ± SEM de três experiências separadas. **,

p Art 0,01; versus controle do vetor vazio.

##,

p Art 0,01; contra o G

α16 Q212L.

G

α16 Regula estimulada por Wnt7a PPAR Activation

A seguir, interrogado se o esgotamento dos G

α16 também bloqueia a longe, a jusante efetoras de Wnt7a /Fzd9 sinalização sinalização

viz.,

PPARy [5]. As células H157 e H2122 foram co-transfectadas com G

sub-siRNAs específica α16 com ou sem os vectores de expressão Wnt7a e PPAR-RE vector repórter de luciferase (Fig. 5A, B). Depleção de G

α16, mas não G

αo, bloqueado selectivamente a activação de PPARy estimulada por Wnt7a em ambas as linhas de células testadas (Fig. 5A, B). Consistente com os efeitos da L

depleção α16 na activação de PPARy Wnt7a-estimulado, a expressão de constitutivamente activa L

α16Q212L, mas não G

αoQ205L, em H157 ou H2122 linhas celulares induziu um aumento robusto na actividade de PPARy ( Fig. 5C, D). efeitos anti-proliferativos Além disso, L

-induzidas α16Q212L no crescimento das células H2122 foram revogada por intoxicação das células transfectadas com inibidor de PPARy (T007090) em ambos H157 (Fig. 5E) e linhas de células H2122 (Fig. 5F). Estes dados sugerem fortemente que os efeitos anti-proliferativos de G

α16 em NSCLC são mediadas através de ERK5 (Fig. 4) e PPARy (Fig. 5).

linhas celulares de NSCLC, H157 (A) ou células H2122 (B) foram transfectadas tanto com siRNA controle ou G

siRNAs específicos de α16 juntamente com o repórter-PPAR-RE luciferase e sem ou com Wnt7a vetor de expressão. Após 48 h, os lisados ​​foram ensaiados quanto a actividade de luciferase tal como descrito nos Métodos. Os dados representam a média ± SEM de três experiências separadas. **,

p Art 0,01; versus controle do vetor vazio.

##,

p Art 0,01; contra Wnt7a. células linhagens de células NSCLC, H157 (C) ou H2122 (D) foram transfectadas quer com vector vazio ou constitutivamente G

Q212L ativa α16 ou G

vetores αo Q205L expressão em conjunto com o repórter PPAR-RE-luciferase. Após 48 h, os lisados ​​foram ensaiados quanto a actividade de luciferase tal como descrito nos Métodos. Os dados representam a média ± SEM de três experiências separadas. **,

p Art 0,01; versus controle do vetor vazio. linhas celulares de NSCLC, H157 (E) ou H2122 (F) foram transfectadas com vector vazio ou constitutivamente activa L

α16Q212L. Após 24 h, as células foram tratadas com ou sem inibidor de PPARy (T0070907, 10 uM) tal como descrito nos Métodos. as taxas de proliferação de células foram depois determinadas usando um ensaio de MTS como descrito nos Métodos. Os dados representam média ± SEM de três experiências altamente reprodutíveis independentes.

##,

p Art 0,01; versus controle do vetor vazio. **,

p Art 0,01; contra o G

α16 Q212L + T007090.

novo papel para ROR1 /2 em Wnt7a /Fzd9 Sinalização

Está bem estabelecido que a ativação de Wnt /β-catenina-dependentes sinalização requer co-receptores de lipoproteínas de baixa densidade (Lrp5 /6) e a proteína G, L

αo [24], [28] – [30]. Uma vez que, nós estabelecemos L

α16 como um mediador fundamental da Wnt7a /Fzd9 sinalização (Fig. 1, 2, 3,4), o próximo avaliadas para o papel de co-receptores, se de todo, na mediação Wnt7a /sinalização Fzd9. Para estes estudos, células H157 e H1299 foram transfectadas com vector vazio ou Wnt7a e Fzd9 plasmídeos de expressão. Curiosamente, a sondagem dos lisados ​​celulares que expressam Wnt7a /Fzd9 revelou um aumento robusto na expressão de receptores de tirosina-quinase de proteína órfãos, ROR1 /2 (Fig. 6A). Embora, o cardinal de co-receptores com a via de sinalização /β-catenina-dependente de Wnt, LRP6 ou a sua forma activada (fosfo-LRP6-S1490) não é afectado (Fig. 6A). Em um forte apoio de nossas descobertas, a sinalização Wnt7a /Fzd9 também não conseguiu estimular a atividade TOPFLASH, um Wnt /β-catenina específico de leitura-out (Fig. 6B). Enquanto que, sob condições semelhantes, Wnt7a /Fzd9 estimulou um aumento robusto na transcrição do gene PPAR-Re-dependentes, como esperado (Fig. 6C). No total, estes dados sugerem que o Wnt7a /Fzd9 via de sinalização, ao contrário do que mecanismo de sinalização β-catenina-dependente, pode sinalizar através da proteína G, L

α16 e os co-receptores, ROR1 /2.

A, H157 e H1299 ou foram transfectadas com vector vazio ou com vectores de expressão Wnt7a e Fzd9. Depois de anticorpos 48-β-actina. As células H157 foram transfectadas com vector vazio ou vectores de expressão e Wnt7a Fzd9 juntamente com qualquer um repórter de luciferase M50-TOPFLASH (B) ou RE-PPAR-luciferase repórter (C). Os controlos positivos usados ​​em experiências repórter M50-TOPFLASH é o vector de expressão β-catenina e, no caso de vector de PPAR-Re-luciferase é o vector de expressão de PPARy. Após 48 h, os lisados ​​foram ensaiados quanto a actividade de luciferase tal como descrito nos Métodos. Os dados representam a média ± SEM de três experiências separadas. **,

p Art 0,01; versus o controlo de vector vazio.

Discussão

Wnt7a foi previamente demonstrado ser essencial para a formação normal do epitélio e para a manutenção de um fenótipo epitelial normal no pulmão [31]. Além disso, a expressão Wnt7a é frequentemente perdido em NSCLC [32]. Foi anteriormente demonstrado que a re-expressão de Wnt7a invertida transformação celular, diminuição do crescimento independente de ancoragem, e induzida a diferenciação epitelial das células NSCLC através do seu receptor cognato Fzd9 [5], [20]. Este efeito é mediado, pelo menos em parte, através da activação dependente de ERK5 de PPARy [5]. Importante, Wnt7a /Fzd9 não ativa a via de sinalização /β-catenina canônica Wnt. Frizzleds, membros do GPCR superfamília [33], exiba muitos dos pontos de referência observados em praticamente todos os GPCRs, incluindo a presença de sete segmentos transmembranares hidrofóbicas previsto para formar alfa-hélices, e três laços intracelulares, bem como uma cauda citoplasmática [33] , [34]. De nota, Fzds também são relatados como estando intimamente associada com as moléculas de adaptador, como o de p-arrestinas, uma proteína adaptadora conhecida envolvida na GPCR de-sensibilização [35] e reguladores da sinalização de proteína G (RGS, [ ,,,0],36]).

G-proteínas são cardinal de GPCR e sinalização foram mostradas para ser envolvido na sinalização /β-catenina canónica Wnt, não canónicas Wnt /Ca

2 + /GMPc e planar vias polaridade celular [34]. Até agora, L

αo e G

αq demonstraram ser críticos durante o desenvolvimento de mamíferos, e teratocarcinoma stem diferenciação celular em resposta a estimulação oncogénica Fzd1 [24]. No entanto, as funções de protecção do tumor para G-proteínas, se for o caso, não foram identificados. No presente estudo, nós identificamos L

αq família das proteínas G, enquanto novos mediadores a jusante da activação Wnt7a /Fzd9-mediada de ERK5 e o gene supressor de tumor PPARy. Pela primeira vez, mostramos que G

αq membros da família, especificamente, G

α16, pode ativar uma sinalização Wnt não-canônico romance. A cascata de sinalização a jusante de G

proteínas alfa envolve diversas e complexas quinases que conduzem finalmente a transcrição de genes regulados e alterações na fisiologia celular. Cada L

αq membro da família tem sido implicada na regulação de uma ou mais da proteína quinase activada por mitogénio (MAPK) vias em culturas de células, embora o mecanismo exacto /s de sinalização permanece obscura. No presente estudo, nós também mostram que L

α16 é o efector a jusante de sinalização Wnt7a /Fzd9 que conduz à activação de ERK5. Interessantemente, outros estudos demonstraram que os GPCRs também pode estimular ERK5 através de mecanismos que envolvem L

αq e G

α12 /13, independentemente de Rho, Rac1 e Cdc42 [37]. No entanto, nós não ver qualquer ativação do PPAR por G

expressão α12 (Fig. 1). Até agora, L

sinalização MAPK mediada por αq está restrito à activação de JNK1 /2 ou ERK1 /2, mas não ERK5. No presente estudo, nós também mostram que um membro da G

αq família, G

α16, como um novo regulador de ERK5. É bem conhecido que o G

αq família (G

αq, G

α11, G

α14, G

α15 /16), após a ativação, se liga e estimula PLC-β- fosfato de inositol mediada pela cascata de sinalização, o que leva à mobilização de cálcio e a activação através PKCα fosfolípido bisfosfonato fosfatidilinositol (PIP2), trifosfato de inositol (IP3) e diacil-glicerol (DAG, [38]). Na mesma linha, a sinalização Wnt7a /Fzd9 também estimulou PLCβ e PKC (dados não mostrados).

Deixe uma resposta